Chapter

1.1. (i) Nucleotide insertion. This is a frameshift mutation. Following this mutation, all but the first triplet encode different amino acids. The functionality is changed and therefore mutation is unlikely to be neutral.

(ii) Nucleotide substitution in which a C was replaced with an A (transversion). The original (CCC) and derived (CCA) codons both specify proline. This is therefore a synonymous substitution and is probably neutral.

1.2. There are 13 transitions and 13 transversions, therefore the ratio is 1.0.

1.3. The primer pair is shown in bold below (in the positions that the primers would anneal to the sequences during PCR):

5'- CTCACTTTCCTCCACGAAACAGGCTCAAACAACCCAACGGGCATCCCCTCAGATTGCGAC -3'

3'- GGGAGTCTAACGCTG - 5'

3'-GAGTGAAAGGAGGTGCTTTGTCCGAGTTTGTTGGGTTGCCCGTAGGGGAGTCTAACGCTG-5'

1.4. The sequence is: TGTGGAAGACCTAAT.

Molecular Ecology Joanna Freeland © 2005 John Wiley & Sons, Ltd.

Was this article helpful?

0 0

Post a comment