Chapter

2.1. Advantages include:

• High mutation rates, therefore relatively likely to detect variation.

• Conserved arrangement of sequences, therefore many universal primers are available.

• No recombination and uniparental inheritance make it relatively easy to retrace genetic lineages.

• Small effective population size compared with most nuclear genes, therefore sensitive to demographic processes.

• Maternally inherited, therefore can be useful when studying hybridization.

Disadvantages include:

• Small effective population size compared with most nuclear genes, therefore may exaggerate the effects of past events and lead to underestimation of genetic diversity.

• Acts as a single locus and therefore there is no scope for comparing the genealogies of multiple genes.

• Maternally inherited and therefore can give an incomplete picture, e.g. if only males disperse.

• Mitochondrial pseudogenes are common in some species.

2.2. (i) Both chloroplasts and mitochondria are maternally inherited in angio-

sperms, therefore this comparison would have to compare data from one of the organelle genomes (dispersed only by seeds) to data from the nuclear genome (dispersed by both pollen and seeds).

(ii) In gymnosperms, mtDNA is maternally inherited (dispersed by seeds only), and cpDNA is paternally inherited (dispersed by pollen only) and therefore would provide a useful comparison. Alternatively, data from cpDNA (dispersed by pollen) could be compared to nuclear data (dispersed by both pollen and seeds).

(iii) Because mtDNA is inherited maternally and Y chromosomes are inherited paternally, different dispersal patterns in males and females could be deduced from a comparison of mtDNA and Y chromosome data; alternatively, a comparison between autosomal loci and mtDNA or Y chromosome markers should reveal any contradictory patterns between the sexes.

2.3. The total number of alleles is 2(28) = 56. There are a total of 18 homozygotes and so there must be 10 heterozygotes, therefore the frequency of A1 = [2(10) + 10]/56 = 53.6 percent and the frequency of A2 = [2(8) + 10]/56 = 46.4 per cent.

2.4. The recognition sites for each enzyme are shown in bold:

1: GATTATACATAGCTACTAGATACAGATACTATTTTTAGGGGCGTATGCTCGG ATCTATAGACCTAGTACTAGATACTAGGAAAACCCGTTGTGTCGCGTGCTGA

2: GATTATACATAGTTACTAGATACAGATACTATTTTTAGGGGCGTATGCTCGG ATCTATAGACCTAGTACTAGATACTAGGAAAACCCGTTGTGTCGCGTGCTGA

Sequence 1 will be cut at two sites and therefore will produce three bands. Sequence 2 will be cut at one site and therefore will produce two bands.

2.5. According to Table 2.4, the average divergence of protein-coding regions in mammalian mtDNA is 2 per cent per million years, which, if the mutation rate is constant, will equal approximately 1 per cent per 500 000 years. We would expect, therefore, to find approximate 5 bp differences in our 500 bp sequence.

2.6. Some of the factors are:

• Variability: are you comparing individuals, populations or species?

• Mode of inheritance: would a biparentally or uniparentally inherited marker be more appropriate?

• Dominant versus co-dominant data: do you wish to readily calculate allele frequencies?

• Will you need to infer the evolutionary histories of populations or species? If so, sequence data may be most appropriate.

• Time, money and expertise: what are your logistical constraints?

Was this article helpful?

0 0

Post a comment