Illegal trade

Natural Synergy

Traditional Chinese Medicine

Get Instant Access

International trade in wildlife is estimated to be worth billions of dollars each year and involves hundreds of millions of plant and animal specimens. Although some of these are traded legally, a substantial proportion involves the lucrative trade of products from endangered species. Examples of these include: caviar from Caspian Sea sturgeon; ingredients such as rhinoceros horns for traditional medicine; pets, including exotic birds and tropical fish; rainforest hardwood trees and other timber; furs and skins for items such as coats and crocodile skin bags; and tourist souvenirs such as jewelry made from coral. In an attempt to reduce the deleterious impact of illegal trade on endangered species, the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) came into force in 1975. Over 160 countries are now signatories to CITES and around 5000 animal species and 28 000 plant species are protected by CITES against overexploitation through international trade (Table 8.1).

Because illegally traded species are often unrecognizable by the time marketable products are seized, it can be extremely difficult to prove that illegal trafficking has occurred. For this reason, the amplification of species-specific regions of DNA has proved an invaluable method for determining which species have been included in a particular product. Traditional Chinese medicine (TCM) is an approach to healthcare that dates back at least 3000 years and treats patients using natural

Figure 8.1 The allele sizes at three microsatellite loci differentiate between red deer and roe deer. Adapted from Poetsch et al. (2001)

Locus 1 Locus 2 Locus 3

Table 8.1 Number of species (spp), subspecies (sspp) and populations (pops) that are protected by CITES against overexploitation through international trade. Data are from www.cites.org

Category Ia Category IIa Category IIIa

Table 8.1 Number of species (spp), subspecies (sspp) and populations (pops) that are protected by CITES against overexploitation through international trade. Data are from www.cites.org

spp

sspp

pops

spp

sspp

pops

spp

sspp

pops

Mammals

aas

a1

13

369

34

14

57

11

--

Birds

146

19

a

1401

s

1

149

--

--

Reptiles

67

3

4

50s

3

4

a5

--

--

Amphibians

16

--

--

90

--

--

--

--

--

Fish

9

--

--

6s

--

--

--

--

--

Invertebrates

63

5

--

a030

1

--

16

--

--

Plants

a9s

4

--

as 074

3

6

45

1

a

Total

sa7

5a

19

3a 540

49

a5

a91

1a

a

"Category I: species threatened with extinction and therefore nearly all international trade is prohibited by CITES. Category II: species that may become extinct unless trade is closely controlled and therefore regulations are strict. Category III: some trading occurs but the cooperation of other countries is needed to prevent unsustainable exploitation.

"Category I: species threatened with extinction and therefore nearly all international trade is prohibited by CITES. Category II: species that may become extinct unless trade is closely controlled and therefore regulations are strict. Category III: some trading occurs but the cooperation of other countries is needed to prevent unsustainable exploitation.

plant, mineral and animal-based ingredients. Unfortunately, some of the most prized ingredients are endangered species, and TCM and the trade that surrounds it is jeopardizing the survival of some of these species. Tiger bones, for example, are used in TCM to treat joint ailments such as arthritis, but tigers (Panthera tigris) are an endangered species with a global population that may number as few as 5000 individuals. A tiger-specific primer pair that will amplify a region of mitochondrial cytochrome b sequence only from samples that contain tiger DNA (Figure 8.2) can be used to determine whether or not meat, dried skin,

Panthera tigris altaica (tiger) P. t. corbetti (tiger) P. t. sumatrae (tiger) P. t. tigris (tiger) P. leo (lion)

Prionailurus bengalensis chinensis (leopard cat) Neofelis nebulosa (clouded leopard) Felis catus (domestic cat) Cervus elaphus hispanicus (Iberian red deer)

GAAATATCGGGATTGTGCTAT GAAATATCGGGATTGTGCTAT GAAATATCGGGATTGTGCTAT GAAACATCGGGATTGTGCTAT GAAACATTGGAATTGTGTTGT GAAACATTGGAATCATACTGC GAAACATTGGAATCGTATTAC GAAACATTGGAATCATACTAT GAAACATCGGAGTAGTTCTTC

Figure 8.2 Sequences from a 20 bp fragment of the mitochondrial cytochrome b gene from four tiger subspecies and five non-tiger species. Variable sites are in bold. The site marked with an arrow differentiates the sequences of tigers from those of other species and therefore can be used to make a tiger-specific primer that, when used in PCR reactions, will amplify a product only from tiger DNA. Adapted from Wan and Fang (2003)

hairs or other material came from a tiger (Wan and Fang, 2003). Tiger bone is sometimes added to other plant and animal derivatives to make TCM pills, and even when tiger bone is at a concentration of only 0.5 per cent it can still be detected using a highly sensitive quantitative PCR technique (Wetton et al., 2002).

A thriving market for exotic food is another reason for illegal trade. Several species of sea turtles are endangered, including leatherbacks (Dermochelys coriacea), green turtles (Chelonia mydas), hawksbills (Eretmochelys imbricata) and flatbacks (Natator depressus), but they still command a high price for meat and eggs. Although trade is flourishing, prosecutions have historically been few and far between, partly because of difficulties in identifying the origin of cooked meat. In a recent study, DNA was extracted from eggs, blood, skin and muscle samples from seven species of marine turtle and two species of freshwater turtle. Analysis of these samples generated species-specific PCR-RFLP markers that could even be applied to cooked meat, and the subsequent identification of processed sea turtle meat has led to the conviction of several restaurateurs (Moore et al., 2003).

Forensic techniques can also be used to characterize bushmeat, a traditional source of food in many African countries. Bushmeat is taken from a range of species, including gorillas, snakes, chimpanzees, antelopes, elephants and crocodiles. Although it can be an extremely lucrative business for the hunters, it can jeopardize endangered species; hunting helped to drive Miss Waldron's red colobus monkey (Procolobus badius waldroni) to extinction in 2000 after it had been a popular source of bushmeat for some years (Oates et al., 2000). The market for bushmeat is global; each week Heathrow airport confiscates an average of 427 kg of animal products that often include some bushmeat. Bushmeat is processed before being transported and therefore few morphologically distinguishing characters remain at the time of seizure, but molecular identification of the component species is possible based on the PCR-RFLP analysis of cytochrome b (Kelly, Carter and Cole, 2003). Some other examples of how wildlife forensics can be used to identify illegally traded food are given in Table 8.2.

Was this article helpful?

0 0
Traditional Chinese Medicine

Traditional Chinese Medicine

Ever wondered what Chinese medicine is all about and whether it works? Thinking about consulting a practitioner but want to know some facts first? Look no further! Here's your chance to purchase an in depth and fully comprehensive eBook on anything and everything to do with this ancient philosophy.

Get My Free Ebook


Post a comment