Polymerase chain reaction

A wealth of information in the genome is of no use to molecular ecologists if it cannot be accessed and quantified, and after 1985 this became possible thanks to Dr Kary Mullis, who invented a method known as the polymerase chain reaction (PCR) (Mullis and Faloona, 1987). This was a phenomenal breakthrough that allowed researchers to isolate and amplify specific regions of DNA from the background of large and complex genomes. The importance of PCR to many biological disciplines, including molecular ecology, cannot be overstated, and its contributions were recognized in 1993 when Mullis was one of the recipients of the Nobel Prize for Chemistry.

The beauty of PCR is that it allows us to selectively amplify a particular area of the genome with relative ease. This is most commonly done by first isolating total DNA from a sample and then using paired oligonucleotide primers to amplify repeatedly a target DNA region until there are enough copies to allow its subsequent manipulation and characterization. The primers, which are usually 15--35 bp long, are a necessary starting point for DNA synthesis and they must be complementary to a stretch of DNA that flanks the target sequence so that they will anneal to the desired site and provide an appropriate starting point for replication.

Each cycle in a PCR reaction has three steps: denaturation of DNA, annealing of primers, and extension of newly synthesized sequences (Figure 1.8). The first step, denaturation, is done by increasing the temperature to approximately 94°C so that the hydrogen bonds will break and the double-stranded DNA will become single-stranded template DNA. The temperature is then dropped to a point, usually between 40 and 65°C, that allows the primers to anneal to complementary sequences that flank the target sequence. The final stage uses DNA polymerase and the free nucleotides that have been included in the reaction to extend the sequences, generally at a temperature of 72° C. Nucleotides are added in a sequential manner, starting from the 3' primer ends, using the same method that is used routinely for DNA replication in vivo. Since each round generates two daughter strands for every parent strand, the number of sequences increases exponentially throughout the PCR reaction. A typical PCR reaction follows 35 cycles, which is enough to amplify a single template sequence into 68 billion copies!

These days, PCR reactions use a heat-stable polymerase, most commonly Taq polymerase, so called because it was isolated originally from a bacterium called Thermus aquaticus that lives in hot springs. Since Taq is not deactivated at high temperatures, it need be added only once at the beginning of the reaction, which runs in computerized thermal cyclers (PCR machines) that repeatedly cycle through different temperatures. Some optimization is generally required when

^ Original template DNA Primer mm Newly synthesized DNA

Forward primer

Original DNA sequence

Step 1. Denaturation

• Reverse primer Step 2. Annealing primers

Step 3. DNA extension

Step 1. Denaturation

Step 2. Annealing primers

Step 3. DNA extension

Figure 1.8 The first two cycles in a PCR reaction. Solid black lines represent the original DNA template, short grey lines represent the primers and hatched lines represent DNA fragments that have been synthesized in the PCR reaction starting with new primers or targeting the DNA of multiple species, such as altering the annealing temperature or using different salt concentrations to sustain polymerase activity. However, once this has been done, all the researcher has to do is set up the reactions, program the machine and come back when all the cycles have been completed, which usually takes 2-3 h. By this time copies of the target region will vastly outnumber any background non-amplified DNA and the final product can be characterized in one of several different ways, some of which will be outlined later in this chapter, and also in Chapter 2.

Primers

An extremely important consideration in PCR is the sequence of the DNA primers. Primers can be classified as either universal or species-specific. Universal primers will amplify the same region of DNA in a variety of species (although, despite their name, no universal primers will work on all species). This is possible because homologous sequences in different species often show a degree of similarity to one another because they are descended from the same ancestral gene. Examples of homology can be obtained easily by searching a databank such as those maintained by the National Centre of Biotechnology Information (NCBI), the European Molecular Biology Laboratory (EMBL), and the DNA Data Bank of Japan (DDBJ). These are extremely large public databanks that contain, among other things, hundreds of thousands of DNA sequences that have been submitted by researchers from around the world, and which represent a wide variety of taxonomic groups. Figure 1.9 shows the high sequence similarity of three homologous sequences that were downloaded from the NCBI website. Primers that anneal to conserved regions such as those shown in Figure 1.9 will amplify specific gene sequences mouse CGGTCGAACTTGACTATCTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA frog CGATCAAACTTGACTATCTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA chicken GAGTGTGAATTGAGTATGTAGAGGAAGTAAAAGTCGTAAGAAGGTTTCCGTAGGTGAACCTGCGGAAGGA

Figure 1.9 Partial sequence of 28S rDNA showing homology in mouse (Mus musculus; Michot et al., 1982), frog (Xenopus laevis; Furlong and Maden, 1983) and chicken (Gallus domesticus; Azad and Deacon, 1980). All sites except for those in bold are identical in all three species from a range of different taxa and therefore fall into the category of universal primers. Table 1.4 shows a sample of universal primers and the range of taxa from which they will amplify the target sequence.

Universal primers are popular because often they can be used on species for which no previous sequence data exist. They can also be used to discriminate among individual species in a composite sample. For example, samples taken from soil, sediment or water columns generally will harbour a microbial community. We may wish to identify the species within this community so that we can address

Table 1.4 Some examples of universal primers and the range of taxa in which they have been used successfully. Forward and reverse primers anneal to either side of the target DNA sequence (see Figure 1.8)

Region

Taxonomic

Sequences of primer pairs

amplified

applications

Reference

Forward primera:

A non-coding

Mosses, ferns,

Chiang,

ACATCKARTACKGGACCAATAA

spacer in

coniferous

Schaal

Reverse primera:

chloroplast

plants,

and Peng

AACACCAGCTTTRAATCCAA

DNA

flowering

(1998)

plants

Forward primer:

Portion of

Fishes,

Wang et al.

TTTCATGTTTCCTTGCGGTAC

mitochondrial

amphibians,

(2000)

Reverse primer:

12S rRNA

reptiles,

AAAGCACGGCACTGAAGATGC

birds,

mammals

Forward primer:

Internal

Insects,

Ji, Zhang

TACACACCGCCCGTCGCTACTA

transcribed

arthropods,

and He

Reverse primer:

spacer (ITS)

fishes

(2003)

ATGTGCGTTCA/GAAATGTCGATGTTCA

of nuclear

rRNA

Forward primer:

Mitochondrial

Mammals,

Hoelzel,

TTCCCCGGTCTTGTAAACC

control

fishes

Hancock

Reverse primer:

region

and Dover

ATTTTCAGTGTCTTGCTTT

(1991)

Forward primer:

Portion of

Mammals,

Kocher et al.

CCATCCAACATCTCAGCATGAAA

mitochondrial

birds,

(1989)

Reverse primer:

cytochrome b

amphibians,

CCCCTCAGAATGATATTTGTCCTCA

reptiles,

fishes

ecological questions such as bacterial nutrient cycling, or identify any bacteria that may pose a health risk. Composite extractions of microbial DNA can be characterized using universal primers that bind to the 16S rRNA gene of many prokaryotic microorganisms or the 18S rRNA gene of numerous eukaryotic microorganisms (Velazquez et al., 2004). In one study, the generation of species-specific rRNA PCR products enabled researchers to identify the individual species that make up different soil and rhizosphere microbial communities (Kent and Triplett, 2002).

Unlike universal primers, species-specific primers amplify target sequences from only one species (or possibly a few species if they are closely related). They can be designed only if relevant sequences are already available for the species in question. One way to generate species-specific primers is to use universal primers to initially amplify the product of interest and then to sequence this product (see below). By aligning this sequence with homologous sequences obtained from public databases, it is possible to identify regions that are unique to the species of interest. Primers can then be designed that will anneal to these unique regions. Although their initial development requires more work than universal primers, species-specific primers will decrease the likelihood of amplifying undesirable DNA (contamination).

There are two ways in which contamination can occur during PCR. The first is through improper laboratory technique. When setting up PCR reactions, steps should be taken at all times to ensure that no foreign DNA is introduced. For example, disposable gloves should be worn to decrease the likelihood of researchers inadvertently adding their own DNA to the samples, and equipment and solutions should be sterilized whenever possible. The other possible source of contamination is in the samples themselves. Leaf material should be examined carefully for the presence of invertebrates, fungi or other possible contaminants. If the entire bodies of small invertebrates are to be used as a source of DNA then they should be viewed under a dissecting scope to check for visible parasites and, if possible, left overnight to expel the stomach contents. Fortunately most parasites, predators and prey are not closely related to the species of interest and therefore their sequences should be divergent enough to sound alarm bells if they are amplified in error.

Despite potential problems with contamination, PCR is generally a robust technique and it is difficult to overstate its importance in molecular ecology. The ability to amplify particular regions of the genome has greatly contributed to the growth of this discipline. Futhermore, because only a very small amount of template DNA is required for PCR, we can genetically characterize individuals from an amazingly wide range of samples, many of which can be collected without causing lasting harm to the organism from which they originated.

Was this article helpful?

0 0

Post a comment