Review Questions

2.1. List some of the advantages and disadvantages of using mitochondrial markers in studies of animal population genetics.

2.2. Which genomes would you target, and why, if you wanted to:

(i) Compare pollen and seed flow in an angiosperm species.

(ii) Compare pollen and seed flow in a gymnosperm species.

(iii) Compare male and female dispersal in a mammal species.

2.3. Twenty-eight diploid individuals from the same population were genotyped at a single locus, and only two alleles (A1 and A2) were found. Ten individuals were homozygous for A1 and eight were homozygous for A2. What are the frequencies of the two alleles in this sample?

2.4. Individuals 1 and 2 from the same population have the following sequences at a particular locus:

1. GATTATACATAGCTACTAGATACAGATACTATTTTTAGGGGCGTATGCTCGG ATCTATAGACCTAGTACTAGATACTAGGAAAACCCGTTGTGTCGCGTGCTGA

2. GATTATACATAGTTACTAGATACAGATACTATTTTTAGGGGCGTATGCTCGG ATCTATAGACCTAGTACTAGATACTAGGAAAACCCGTTGTGTCGCGTGCTGA

If these sequences are digested with two restriction enzymes - AluI, which cuts DNA sequences of AGCT and RsaI, which cuts DNA sequences of GTAC - how many bands will each sequence produce?

2.5. Two mtDNA lineages in a mouse population diverged around 500 000 years ago. If you are comparing a 500 bp stretch of DNA from a protein-coding region from two mtDNA haplotypes, approximately how many base pair differences would you expect to find, based on the data in Table 2.4?

2.6. What are some of the factors that need to be taken into account when deciding which molecular markers you would use in an ecological study?

Was this article helpful?

0 0

Post a comment