Review Questions

5.1. A 750 bp long region of the cytochrome b mitochondrial gene was sequenced from two geminate fish species living either side of the Isthmus of Panama. When the sequences were aligned, 23 of the bases did not match. Calculate the molecular clock for cytochrome b in this genus. What assumptions must you make before you apply this clock to other studies that are based on cytochrome b sequence data?

5.2. How many generations ago should all copies of a) a nuclear (diploid) gene, and b) a mitochondrial gene, have coalesced in a population with Ne = 200? What are some of the assumptions that we make when calculating this probability?

5.3. Assuming that haplotype 1 is central to the network, construct a parsimony network from the six haplotypes that are identified by the following sequences (variable sites are written in bold):

Haplotype 1: GATAGTAGGGGTTAGATACTAAATACGTAGACTAGCTAT Haplotype 2: GATAGTAGGGATTAGATACTAAATACGTAGACTAGCTAT Haplotype 3: GATAGTAGGGATTAGATACTAAATATGTAGACTAGCTAT Haplotype 4: GATAGTAGGGGTTAGAAACTAAATACGTAGACTAGCTAT Haplotype 5: AATAGTAGGGGTTAGATACTAAATACGTAGACTAGCTAT Haplotype 6: AATAGTAGGGGTTAGATACTAAATACGTAGACTAACTAT Haplotype 7: GGTAGTAGGGGTTAGATACTAAATACGTAGACTAGCTGT

Although you have no information on the frequencies of these haplotypes, does coalescent theory allow you to identify the most likely ancestral haplotype in this network?

5.4. Briefly describe two processes that can explain the sharing of alleles between two populations or species.

5.5. Two closely related species live mostly in allopatry, with species A occurring in western Canada and species B occurring in eastern Canada. A narrow hybrid zone can be found where they come into contact with one another, but the majority of hybrids are males.

(i) Are these species more likely to be birds or mammals? Why?

(ii) Is this more likely to be a tension zone, or to show bounded hybrid superiority? Why?

(iii) If hybrid males backcross into both parental populations, would you expect to find similar levels of introgression of mitochondrial and nuclear DNA? Why?

Was this article helpful?

0 0

Post a comment