Review Questions

1.1. A particular DNA sequence is transcribed into the following RNA sequence in which the bases are grouped as codons:

GCG CCC CAA UGU UGG ACC

Within a population, two mutations occur that result in slight modifications of the same sequence:

GCG GCC CCA AUG UUG GAC C GCG CCA CAA UGU UGG ACC

In each case, what type of mutation has occurred, and is it likely to be selectively neutral?

1.2. Below are two partial cytochrome b mitochondrial sequences (180 bp each) from a pair of neotropical warbling-finches in the genus Poospiza (after Lougheed et al., 2000). Sequence differences are in bold type. What is the ratio of transitions to transversions in these two sequences?

P. alticola CTCACTTTCCTCCACGAAACAGGCTCAAACAACCCAACGGGCATCCCCTCAGATTGCGAC P. baeri CTGACTTTCCTACACGAAACAGGCTCAAACAATCCAATAGGAATCCCCTCAGACTGCGAC

P. alticola AAAATTCCCTTCCACCCATACTACACCATCAAAGACATCTTAGGATTCGTACTAATACTC P. baeri AAAATCCCCTTCCACCCCTACTACACTATCAAAGACATCCTAGGCTTCGTAATCATACTC

P. alticola ACCCTATTAGTCTCACTAGCTTTATTCTCCCCCAATCTCCTAGGCGACCCAGAAAATTTC P. baeri TCCCTACTCGCATCACTAGCCCTATTCGCCCCCAACCTACTAGGAGACCCAGAAAACTTC

1.3. Provide sequences for a pair of primers, each 15 bases long, that could be used to amplify the following sequence in a PCR reaction:

5' —CTCACTTTCCTCCACGAAACAGGCTCAAACAACCCAACGGGCATCCCCTCAGATTGCGAC - 3' 3'-GAGTGAAAGGAGGTGCTTTGTCCGAGTTTGTTGGGTTGCCCGTAGGGGAGTCTAACGCTG - 5'

1.4. A dideoxy sequencing reaction gives target DNA sequence fragments of the following sizes:

Reaction with ddG: 2, 4, 5 and 8 bases Reaction with ddA: 6, 7, 9, 13 and 14 bases Reaction with ddT: 1, 3, 12 and 15 bases Reaction with ddC: 10 and 11 bases

What is the sequence of this region of DNA?

Was this article helpful?

0 0

Post a comment